Diskhash indexed fasta reader

Little package for indexing fasta files with diskhash and using fasta files indexed in this way.

Use examples

Indexing fasta file

To create a diskhash based index for a fasta file use the index_fasta command line tool:

index_fasta GMGC10.10.fna

Using indexed fasta file (command line)

Use the fasta_reader command line tool passing as a first argument the previously-indexed FASTA file and then a list of sequences to retrieve

fasta_reader GMGC10.10.fna GMGC10.027_772_348.UNKNOWN GMGC10.014_522_894.UNKNOWN

Will produce

>GMGC10.027_772_348.UNKNOWN
ATGTATGACTGCGGGCACTACCTGCCAGAGCCGTTCCCGGATGAACTGGCGGATGAATTCAGAATGTTCTTTCTCTTGAATCGCCACGGGTTTAACAGACACCTCCGAGTCATTTAA
>GMGC10.014_522_894.UNKNOWN
ATGAATATATCGGAAATTGAAAAAATCGCAGCAAAGGAAATATTATTATGGGTTAAAGAGAGGATATTTCAGAAAAATGCCCTCCCGTTCAAGGGGAAGGCGAGGAATTACAGATAG

Note that if the sequence is not found, then no output is produced

Using indexed fasta file (from Python)

Sequences from diskhash indexed fasta file can be accessed using IndexedFastaReader:

from fasta_reader import IndexedFastaReader

ifr = IndexedFastaReader(fasta_file='my_fasta.fna', index_file='my_index.dhi')

# check length of sequence
ifr.get_length('my_seq_id1')
# get the sequence
ifr.get('my_seq_id1')
# check number of sequences
ifr.index.size()

Dependencies

diskhash package is required. Code was tested with version 0.2. When installed with setup.py, the package will be installed from pypi.